Féy, 57420
Bienvenue à Féy, commune française située dans le département Moselle et la région Lorraine.Vous trouverez ici quelques infos sur la commune et notre sélection de sites sur Féy.
     
 
 

Féy en bref

Département : Moselle
Code postal : 57420
Population : 0 habitants
Région : Lorraine
Arrondissement : Metz-Campagne
Canton : Verny

Sites sur Féy

  • Aquarium Stock Photography Images From SuperStock
    1890-57420. Ocean World, Siam Paragon shopping mall, Bangkok, Thailand, Southeast Asia, Asia
  • Full text of "Annuaire statistique [afterw.] Annuaire du dà ...
    Full text of "Annuaire statistique [afterw.] Annuaire du département du Nord. An xi-1890"
  • Full text of ""
    Full text of ""
  • www.netlib.org
    c dy/dt = f(y,t), y=(y(1),y(2),y(3), . . . ,y(n)) c and linearly implicit differential algebraic equations. c m(dy/dt) = f(y,t)
  • www.omhmali.org.ml
    ... marchΘ"boulkassoumbougou rue 665 porte 46&lafiabougou av cheick zayed porte 729 *lafiabougou porte 725*bakaribougou rue 607 porte 164*yirimadio prΦs cours d'appelNS 57420 ...
  • Titin (TTN) - coding DNA reference sequence
    aaatacacattttacgcgggagaaaatatcacatctggaaaacttactgtggcag | gtggg 7860 k y t f y a g e n i t s g k l t v a g | g 2620 ...
  • Sibling Rivalry
    Jonny was here preteen photos of nude models 935756 preteen photo art model hvj pics of naked kids 598 trisha bathing >:[[[ pthc vicky tqpx vajinas muy peludas 57420 jp18 qakqi shy ...
  • www.netlib.org
    c dy/dt = f(y,t), y=(y(1),y(2),y(3), . . . ,y(n)) c subroutine ovdriv is a ... do 57420 i = 1,n ddown = ddown + (y(i,l)/scale(i))**2 ...
  • PTC Result of Gujarat | Online information free, Primary Teaching ...
    i have bored because of i try to all day for F.Y PTC result but i could not fint it. ... please send this ptc second year result , scroll no-56837 & 57420, please send this my ...
  • EMBL: BX640420 | dbfetch | EBI
    Search for EMBL: BX640420 ... EBI Dbfetch ID BX640420; SV 1; linear; genomic DNA; STD; PRO; 348134 BP.
  • Carte de Féy

     
     
     
     
     
     
      Communes françaises
     
     
      Autres communes du canton
     
     
      Communes proches
     
     
      Départements français
    01.Ain.  02.Aisne.  03.Allier.  04.Alpes-de-Haute-Provence.  05.Hautes-Alpes.  06.Alpes-Maritimes.  07.Ardèche.  08.Ardennes.  09.Ariège.  10.Aube.  11.Aude.  12.Aveyron.  13.Bouches-du-Rhône.  14.Calvados.  15.Cantal.  16.Charente.  17.Charente-Maritime.  18.Cher.  19.Corrèze.  21.Côte-d'Or.  22.Côtes-d'Armor.  23.Creuse.  24.Dordogne.  25.Doubs.  26.Drôme.  27.Eure.  28.Eure-et-Loir.  29.Finistère.  2a.Corse du Sud.  2b.Haute-Corse.  30.Gard.  31.Haute-Garonne.  32.Gers.  33.Gironde.  34.Hérault.  35.Ille-et-Vilaine.  36.Indre.  37.Indre-et-Loire.  38.Isère.  39.Jura.  40.Landes.  41.Loir-et-Cher.  42.Loire.  43.Haute-Loire.  44.Loire-Atlantique.  45.Loiret.  46.Lot.  47.Lot-et-Garonne.  48.Lozère.  49.Maine-et-Loire.  50.Manche.  51.Marne.  52.Haute-Marne.  53.Mayenne.  54.Meurthe-et-Moselle.  55.Meuse.  56.Morbihan.  57.Moselle.  58.Nièvre.  59.Nord.  60.Oise.  61.Orne.  62.Pas-de-Calais.  63.Puy-de-Dôme.  64.Pyrénées-Atlantiques.  65.Hautes-Pyrénées.  66.Pyrénées-Orientales.  67.Bas-Rhin.  68.Haut-Rhin.  69.Rhône.  70.Haute-Saône.  71.Saône-et-Loire.  72.Sarthe.  73.Savoie.  74.Haute-Savoie.  75.Seine.  76.Seine-Maritime.  77.Seine-et-Marne.  78.Yvelines.  79.Deux-Sèvres.  80.Somme.  81.Tarn.  82.Tarn-et-Garonne.  83.Var.  84.Vaucluse.  85.Vendée.  86.Vienne.  87.Haute-Vienne.  88.Vosges.  89.Yonne.  90.Territoire de Belfort.  91.Essone.  92.Hauts-de-Seine.  93.Seine-Saint-Denis.  94.Val-de-Marne.  95.Val-d'Oise.